Role Of Dhh In Proliferation Of Peripheral Tcells Biology

Essay add: 12-01-2017, 11:04   /   Views: 2

The tissue development plays an important part in animal physiology. This is in part controlled by morphogens. Morphogens are substances that have the ability to determine the developmental fate of an embryo. They are indispensible diffusible factors that govern tissue morphology. During development, different morphogens are produced within the embryo or by cells of the surrounding maternal tissues. These morphogens diffuse through the embryonic tissue, each of them establishing its own concentration gradient and forming a chemical pattern which is the basis of embryonic development. A concentration gradient is generated from a particular source by the mechanism of diffusion or movement. Then dependent on the position of the target cell within the gradient the cell will respond accordingly within that very particular area. This results in the generation of different patterning signals (Varas et. al., 2003). Morphogens primarily determine tissue patterning and cell fate. They play a particularly important role in cell fate determination of the adult human tissues which have the ability to self-renew that is observed in the system haematopoiesis. The signalling events generated by morphogen gradients are very complex and regulates the patterning of different regions of the embryo.

In humans, generally there are four families of morphogens which are very critical in development and proliferation of T-lymphocytes (list these), of which the Hedgehog proteins (Hh) are quite essential in for gonad development, bone formation, neurogenesis and haematopoiesis (Bijlsma et. al., 2006). Generally T cells originate from the haematopoietic stem cells in the bone marrow, which migrate to the thymus where T-lymphocytes are fully developed into functional T cells. During T cell development in the thymus, the T cells gradually develop characteristic cell suface markers which include CD4 and CD8. The thymocytes which are developed initially, do not express either of CD4 and CD8 markers and are coined as double-negative (CD4-CD8-) cells. During the process of T cell development these thymocytes become double-positive (CD4+CD8+) cells as they express both of CD4 and CD8. The final development of the thymocytes into mature T cells is marked by single-positive (CD4+CD8-/ CD4-CD8+) cells which gradually get released from the thymus into the peripheral tissues, where they are known as Peripheral T Cells. The morphogens also play a vital role in T cell proliferation. In the periphery when, T cells are in a state of rest, cytokines like IL2, IL4 are not produced and the expression of their receptors comes to a halt. Therefore there are no sign of any IL2 receptors. Thus, when the T cells are activated, the high affinity IL2 receptors are formed which further induces the secretion and synthesis if IL2 and IL4. These then bind to their receptors and the T cells proliferates. The stage of proliferation is terminated when the cytokine stimulation is stopped and the receptors decay.

Figure 1| T CELL PROLIFERATION

As cited before, out of the four families of morphogens in human physiology, Hedgehog (Hh) proteins are very important. These are small, secreted proteins which play a role in a development both in the embryo and the adult and tumorigenesis (Bijlsma et. al., 2006). The hedgehog proteins undergo many multiple processing steps which results in cleavage of the signal sequence, followed by the catalyzation of the C-terminal domain of the Hh polypeptide through an intramolecular cholesteroyl transfer reaction that results in the formation of cholesterol-modified N-terminal Hh signalling domain (HhN) (Porter et. al., 1996). The perception by a cell of a morphogen concentration is determined by the total number of receptors which are active on a cell with respect to receptors that are inactive. Hedgehog signalling occurs through two transmembrane proteins, twelve-pass membrane patched (Ptc), the receptor for the morphogen hedgehog, which is active in the absence of ligand. This blocks the expression of the target gene by the inhibition of the seven pass G-protein coupled receptor Smoothened (Smo), which is an essential transducer of the Hh signal (Casall and Struhl et. al., 2004). The reaction of Ptc and Smo results in the transcriptional changes mediated by the transcription factors GLI1, GLI2 and GLI3; GLI2 and GLI3 act as transcriptional activators and repressors in the presence and absence of Hh respectively, while GLI1 only acts as an activator of transcription (Rowbotham et. al., 2008). GLI3 is known to be bound in a protein complex by the action of Fused (Fu), Costal2 (Cos2) and Suppressor of Fused (SuFu). Smo inhibition by Ptc is a catalytic mechanism and a strong homology exists between Ptc and some bacterial transporter molecules like Niemann-Pick C (NPC1) protein, which is involved in the cholesterol homeostasis in humans. (Bijlsma et. al., 2006).

Figure 2| A COMMON Hh SIGNALLING PATHWAY

(Crompton T, Outram SV, Hager-Theodorides AL. Nat Rev Immunol. 2007 Sep;7(9):726-35.)

Hh signalling is very important for both embryonic development and homeostasis of adult tissues. The latter includes thymus and blood as well. In the thymus, Hh signals for differentiation, survival and proliferation in the initial stages of T cell development, before T Cell Receptor (TCR) gene arrangement. (Outram et al 2000 Immunity, Rowbotham et. al., 2007). Hh signalling is necessary for T cell development in both mice and humans. Hh, as cited above, is expressed by the thymic epithelial cells. The components of the Hh singaling pathway are generally expressed in the lymphoid and stromal compartments of the thymus. Hh signalling is crucial for homeostasis of the double-negative cells, differentiation from DN1 and DN2 and the double-negative to double-positive transition (Outram et al 2000, Shah et al, 2006, Rowbotham et. al., 2007). The active Hh protein is a mature protein which is derived from autocatalytic cleavage of a precursor protein and is guided by the addition of cholesterol and a palmitoyl group. It is the only known sterolated protein that is available in the animal world. In the thymus, reduced Hh signalling (Hh-/-) promotes differentiation to the CD4 lineage which results in the increased ratio of CD4:CD8, while increased Hh signalling results in the decrease of CD4:CD8 ratio (Shah et al 2006). Hh signalling also negatively influence both of the positive and negative selection of the T lymphocytes

In the thymus and also antagonizes in vitro T cell activation and proliferation. (Rowbotham et. al., 2007).

The vertebrate hedgehog family is consisted of three particular members: Indian Hedgehog (Ihh), Sonic Hedgehog (Shh) and Desert Hedgehog (Dhh). To date, most of the research has been done on Shh and to a lesser extent Ihh (Crompton et. al., 2007, Outram et al 2009). The Desert Hedgehog protein is encoded by the Dhh gene. Research on Dhh signaling has been limited to the germ line cells where, in sertoli cells in the testis Dhh binds to Ptc in the germ cell and GL1 is activated through this signalling cascade (Kroft et. al., 2001). The role of Dhh in the fate of T cell development and in T cell proliferation has not yet been investigated. Thus the purpose of this research project is to reveal any role for Dhh in T cell development and, in particular, T cell proliferation following an activation stimulus delivered in vitro by anti-CD3 and anti-CD28. The degree of proliferation will be analysed by staining T cells with propidium Iodide and CFSE.

Aim

The research aims to establish a role for Dhh in the proliferation of peripheral T cells.

Objectives

To isolate T lymphocytes from the spleens of homozygote, heterozygote and wild type Dhh mice

To analyze the ability of these T cells to proliferative following an activation stimulus

To determine the size of the spleens isolated from homozygote, heterozygote or wild type Dhh mice

To ascertain the expression of CFSE on CD4 and CD8 T cells following an activation stimulus through anti-CD3 and anti-CD28 in vitro

To measure the percentage of cells in cell cycle following a stimulus through anti-CD3 and anti-CD28 using propidium Iodide

To determine the genotype for the wild type and mutant Dhh alleles for the mice used in each experiment

Research questions

Does the role of Dhh alter the CD4 and CD8 ratio in T cell development?

Will T cell proliferation occur normally in the absence of Dhh?

MethodologyAnimals

Dhh+/- and Dhh-/- mice will be bred and maintained in the animal facility at the Institute of Child Health/UCL.

Estimation of spleen size

First of all, an estimation of homozygote, heterozygote and wild type mice spleen size will be made. This will be done by counting the isolated cells from the spleen from the above described mice.

Flow cytomerty

The cells were stained using combinations of anti-CD4, anti-CD8 and anti-CD3 fluorescently conjugated antibodies obtained from e-bioscience

Cell suspensions were stained with the antibodies for 30 min on ice in 50 μl of PBS supplemented with 5% FCS and 0.01% sodium azide. The cells were washed in this medium between incubations and prior to analysis on the FACScan (fluorescence-activated cell scan; Becton Dickinson, Franklin Lakes, NJ located at ICH/UCL). The events were collected in list mode using CellQuest software (Becton Dickinson), and the data were analyzed using CellQuest Pro software. Live cells were gated according to their forward scatter and side scatter profiles. The data are representative of at least three experiments.

In vitro T-cell activation

Splenic T cells were cultured at 5 - 106/mL in AIM-V (Life Technologies), 10−5 M 2ME (Sigma-Aldrich) at 37°C, 5% CO2. Anti-CD3 and anti-CD28 (azide-free [NA/LE; BD PharMingen]) were at 0.01 μg/mL of each, unless otherwise stated

Estimation of proliferation using CFSE

Before setting splenocytes up in culture as above cells will first be stained with Carboxyfluorescein succinimidyl ester (CFSE). CFSE is a fluorescent dye which allows estimation of the percentage of cells having undergone rounds of cell cycle. As the level of expression of CFSE is reduced by 50% each time a cell divides estimation may be made of exactly how many rounds of cell cycle a particular cells has undergone. CFSE (Sigma-Aldrich) labelling was carried out in PBS and 10 μM CFSE for 10 minutes at 25°C in the dark.

Using simultaneous staining with anti-CD4 and anti-CD8 we will be able to estimate the percentage of CD4 and CD8 T cells that have undergone rounds of cell cycle

A typical CFSE staining profile derived from peripheral CD4 T cells following an activation stimulus in vitro. Each finger-like process represents another round of cell division.

Estimation of percentage of cells in cell cycle using propidium Iodide

Cultured splenocytes were resuspended at 5x 10(6)/ml and incubated in

200 μl PI-solution in PBS: 50 μg/ml PI , 0.1 mg/ml RNase A 0.05% Tritin X-100 Incubate for 5 inutes in the dark at room temperature. Following this period cells were analysed on a FACScan as above.

A typical PI profile derived from cells in cycle.

Genotyping

In all experiments mice need to be genotyped for the wild type and mutant Dhh alleles. This will be done by polymerase chain reaction on tail biopsy of mice.

Genotyping will be done by two step, DNA extraction and polymerase chain reaction.

DNA extraction

DNA from mice was extracted from 2mm tail tip biopsies by placing in 100l lysis buffer (50mM KCL, 10mM Tris HCL (pH 8.5), 1.5mM MgCL2, 0.01% gelatin, 0.45% Noident P-40, 0.45% Tween20) and 0.5g/ml Proteinase K(Sigma-Aldrich) in ultra pure water (Life Technologies) and incubating on a shaker at 500rpm at 56°C overnight or 1200 for 1.5hrs. The samples were then spun at 13000rpm in a micro-centrifuge for 5 minutes before use.

Polymerase chain reaction (PCR)

DNA (1l) prepared as above was used as a template in each PCR reaction. The primers used for amplifying the specific PCR products are

Dhh wildtype gene

Forward (Dhh WT f)

ATCCACGTATCGGTCAAAGC

Reverse (Dhh r)

GGTCCAGGAAGAGCAGCAC

Dhh mutated gene

Forward (Dhh KO f)

GGCATGCTGGGGATGCGGTG

Reverse (Dhh r)

GGTCCAGGAAGAGCAGCAC

Each PCR reaction was carried out in 20l mix consisting of DNA, 50% GreenTaq DNA Polymerase (Sigma-Aldrich) and 1M of each relevant primer made up with ultra pure water (Life Technologies). PCR was carried out on a Stratagene Robocycler (Stratagene) as follows: 5 minutes at 94°C, 38 cycles for 1:30 minute at 94°C, 1 minute at 58°C, 1:20 minute at 72°C and 10 minutes at 72°C.

PCR products were resolved on a 2 % agarose (Sigma-Aldrich) 1x TBE (Life Technologies) gel, stained with 0.001mg/ml ethidium bromide (Sigma-Aldrich). A 1kb plus molecular weight marker (Life Technologies) was also electrophoresed to estimate band size of samples. The gel was visualized under ultraviolet light (Herolab, Germany) and a photograph taken (Sony).

Statistical analysis of data

In order to carry out apt and proper statistical analysis on all investigations, all experiments will be repeated for three and analysed using the students T test to determine the level of significance of. 

Article name: Role Of Dhh In Proliferation Of Peripheral Tcells Biology essay, research paper, dissertation