The Detection Of Bacteroides Spp Biology

Abstract

This study aimed to design primers to amplify a section of the 16S rDNA gene unique to Bacteroides spp. from dog, allowing differentiation of these isolates from Bacteroides spp. from other animals. A dog-specific Bacteroides spp. 16S rDNA gene was amplified and sequenced to facilitate the design of specific primers. Three primer sets were tested, DF53F and DF606R showed no results with all DNA faecal samples except a strong reaction was seen with a DNA of Bacteroides from dog faeces at a product size of 572 bp, DF113F and DF472R, successfully amplified the DNA samples extracted from dog faeces with a product size of 379 bp and showed no amplification with other faecal samples such as human, cow horse, pig, sheep, deer, cat and duck. DF418F and DF609R were strongly positive with the Bacteroides DNA of dog and weak positive with DNA of human faeces with a product size of 210 bp and showed a negative with other animal samples. The use of the first and second primer sets can be useful to discriminate dog originating Bacteroides strains from Bacteroides isolates from other animals. The PCR developed could be used for the detection of pollution of bathing water and beach sediments with dog's faeces. 

1: Introduction

Usually, microscopic examination, biochemical reaction, and selective culture plating methods of faecal samples from humans and animals can differentiate between the population of anaerobic bacteria in the gastrointestinal tract of humans and animals (Moore and Moore, 1995, Wang et al., 2002). Kreader (1995) mentioned that the detection of faecal indicator bacteria (FIB) to determine faecal water pollution, but these bacteria are found in a variety of warm-blooded and are not unique to host-specific intestinal flora of human and animals. For these reasons, the need to distinguish between sources of faecal water pollution has stimulated the search for species-specific indicators. A few limitations of using ordinary FIBs, including that FIBs have been shown to replicate in the environmental water, they are not host-specific and the absence of FIB that is not necessarily the absence of pathogens. Preferably these FIBs could decay at the similar rate as pathogens, present at high concentrations in faecal sources and present at low concentrations in the uncontaminated environmental system (Savichtcheva and Okabe, 2006, Santo Domingo et al., 2007, Stewart et al., 2008, Schriewer et al., 2010). On the other hand, Layton et al. (2006) proposed that Bacteroides species can be used as a faecal indicator to differentiate between the livestock's Bacteroides and those from human faecal which contaminate bathing water because of their a high concentration in faeces and potential host specificity.

To understand microbial community structure and function in specific ecosystems, most researchers have utilized the 16S rDNA gene and phylogenetic analysis markers of bacteria (Perumbakkam and Craig, 2011, Zhou and Hernandez-Sanabria, 2009, Rastogi and Sani, 2011). The essential and powerful tool for bacterial studies is PCR-based analysis of 16S rDNA genes to know the diversity, community structure, evolution and taxonomy (Hongoh et al., 2003). In addition, various strategies have been followed to track bathing water system contaminating bacteria; microbial source tracking is an increasingly used methodology to determine host-specific contributions of faecal contamination to water systems, thus helping resolve these unknown sources. One bacterial source tracking method is the detection of host-specific 16S rDNA markers of Bacteroides-Prevotella, which are found exclusively in the faeces of humans and animals, often in abundance than usually coliform bacteria (Paster et al., 1994, Kildare et al., 2007). Microbial source tracking aims to determine the relative amounts of host-specific faecal contamination in bathing water samples. In the methodology of Bacteroides spp., the main objective is to directly quantify of host-specific depends on a relationship between the total concentration of Bacteroides sequences and host-specific markers detected (Kildare et al., 2007). The 16S rDNA gene used to analyse complex microbial communities in environmental studies and it has two limitations. The heterogeneity in gene copy number among bacterial species and it is making the gene is an inaccurate as the first limitation (Case et al., 2007). The second limitation is an inability to differentiate closely related as species and strains (Khamis et al., 2004). However, because these disadvantages, the researchers looked at alternative universally present genes that occurs as a single copy and can be used in conjunction with the 16S rDNA gene marker (Perumbakkam and Craig, 2011). On the other hand, in 2012, the enumeration of dogs in the UK is around 8 million and about 23% of the UK households have as a minimum one dog http://www.pfma.org. uk/pet-population/. Faecal materials of domestic dog contain billions of bacteria and these bacteria contaminate water surface when it carried during rainfall http://www.yuckos.com/water.html. This study aimed to design specific primers to amplify a section of the 16S rDNA gene unique to Bacteroides spp. from dog (Canis lupus familiaris), allowing differentiation of these isolates from Bacteroides spp. from other animals.

2: Material and Methods

2-1: Samples collection and DNA extraction

Ten dog faecal samples were collected from the South West England, Devon. Genomic DNA was extracted from dog faeces (200 mg) using QIAamp Stool DNA Mini Kit according to the manufacturer's instructions (Qiagen, UK) with a few modifications. 500 µl Lysozyme (50 mg/ml, Sigma, UK) was added to faecal samples and incubated at 37 °C for 30 min; next, the pellet was suspended in 100 µl AE buffer and stored at -20 °C. The purity and quantity of DNA samples were measured using the NanoVue™ Spectrophotometer (Fisher Scientific, UK). Two µl of each sample was used for the quantification of DNA from the samples. The final AE buffer was used as blank to check the spectrophotometer before use.

2-2: PCR amplification

The Polymerase Chain Reaction (PCR) was used to detect Bacteroides-Prevotella 16S rDNA gene in the faecal samples by using published universal Bacteroides primer forward Bac32F [5'- AAC GCT AGC TAC AGG CTT-3'] and reveres Bac708R [5'- CAA TCG GAG TTC TTC GTG-3'] (Bernhard and Field, 2000b, Bernhard and Field, 2000a). The PCR was carried out in a total volume of 25 µl reaction mixture containing 5 µl of template extracted DNA (50 ng/µl), 1 µl (2 pmol/ µl) of forward and reverse primers (eurofins, MWG, Germany), 5.5 µl Water Molecular Biology Grade (Fisher Scientific, UK). 12.5 µl Taq DNA polymerase with buffer (Sigma Aldrich, UK). The cycling parameters were 15 minutes at 95 °C for initial denaturation, after that 35 cycles of 94 °C for 30s, 53.7 °C for 1 min as annealing temperature, 1 minute at 72 °C, followed by extension at 72 °C for 6 minutes (Bernhard and Field, 2000b). Finally, to detect the amplified products, 8 µl aliquots of the PCR product was visualized through 1.7% agarose gel with safe DNA gel stain (SYBR, Fisher, UK) and exposure to ultraviolet (UV) light (Bio-Rad UV, CHEMI DOC XRS) to confirm the band of the expected size was obtained.

2-3: Clean-up

The PCR products were purified by using SureClean System as described by the manufacturer's protocol (Bioline, UK). Briefly, an equal volume of Sure-clean was added to the nucleic acid solution and mix thoroughly, then a volume of 70% Ethanol equal to 2X original sample volume was added and vortex for 10 Sec. The eluted DNA was re-suspended in 22 µl volumes of Water Molecular Biology Grade (Fisher, UK), also the both purity and quantity were measured by spectrophotometer.

2-4: Gene sequence analysis

The purified PCR ampilicons were commercially sequenced using value read service from Genome Analysis and Technology Core (GATC BIOTECH, UK) and using both primer reading (Bac32F and Bac708R). Identification of Bacteroides spp. were performed by using blast software online from National Centre for Biotechnology Information (NCBI BLAST). The NCBI BLAST software was used to identify the sequences identity and the evolutionary relationship (phylogenetic tree) between the 16S rDNA gene from dog's Bacteroides and other animals (human, cow horse, pig, sheep, deer, cat and duck) using the Clustalw2 software <http://www.ebi.ac.uk/ Tools/ msa/ clustalw2/> from the European Bioinformatics Institute (EBI) utilizing blast results. Moreover, the Clustalw2 were also used to produce the multiple sequence alignments pattern between the 16S rDNA gene from dog's Bacteroides and the others.

2-5: Primer design and PCR amplification

The mismatching sequence regions of the dog sequencing of 16S rDNA gene were utilized to design specific primers for the dog's Bacteroides. Three sets of primers were designed DF53F, DF606R, DF113F, DF472R, DF418F and DF609R to amplify the 16S rDNA gene of the dog's Bacteroides and the PCR amplification was achieved using the flowing program 94 °C for 2 min followed by 30 cycles start at 94 °C for 30 Sec denaturation and for annealing temperature which optimized using different temperatures (55, 57, 60 and 62.5 °C) of each primer set and then amplification was at 72 °C for 30 Sec.

Each set of three primers was experimentally tested by performing PCR on genomic DNA isolated from Bacteroides spp. from human, cow, pig, horse, sheep, deer, cat and duck. The annealing temperature of new primers was optimized by raising it from 55 °C to 65 °C. The amplified products were analyzed in 1.7% agarose gels and the images were captured using the Gel Documentation System. The experiments were performed at least 3 times. PCR products were cleaned again as described before, and DNA concentration measured by NanoVue™ spectrophotometer. Then the purified products were sequenced again by GATC UK.

3: Results

3-1: Bacteroides 16S amplification using generic Bacteroides primers

The 16S rDNA gene of Bacteroides was successfully amplified out of the dog's Bacteroides genomic DNA isolated from the dog faecal. Furthermore the general Bacteroides primers (Bac32F and Bac708R) were also amplified Bacteroides 16S rDNA gene from other animals (human, cow, pig, horse, sheep, deer, cat and duck). The results showed unique PCR ampilicon produced from the dog Bacteroides 16S gene amplification with 676 bp compare to the DNA ladder (Figure 1).

676 bp

Figure : Bacteroides generic primer (Bac 32F and Bac 708R) amplified with DNA from dog faecal samples at product size 676 bp.

3-2: Specific primer design for 16S rDNA gene

The sequences from Bacteroides 16S rDNA genes were used to design specific primers differentiating 16S gene rDNA ampilicons of dog's Bacteroides species amongst other Bacteroides related to the animals. Three sets of dog-specific primers were designed from the Bacteroides 16S rDNA isolated from dog's faeces (Table 1). The Checker of primer and probe, ARB and NCBI-BLAST software programs were used to compare the target sequence region of 16S rDNA gene of Bacteroides spp with others Bacteroides gene origin.

Table : The three sets of dog-specific Bacteroides primers used in this study

Primers

Primer sequences

Annealing temp.(°C)

Length

Amplicon

size (bp)

Sources

DF53F

TATCCAACCTCCCGCATAC

60

19

572

This study

DF606R

CATTTCACCGCTACACCAC

60

19

-

DF113F

ATCTCAAGAGCACATGCAA

60

19

379

DF472R

AATAAATCCGGATAACGCTC

60

20

-

DF418F

ACGAATAAGCATCGGCTAAC

60

20

210

DF609R

AAGCATTTCACCGCTACA

60

19

-

The annealing temperature of each primer set was optimized and it was found that 60 °C is the optimal annealing temperature producing signal band at the expected the molecular size 572, 379 and 210 bp, and after a maximum of 35 cycles of PCR, DNA products were produced from dog tested Bacteroides, whereas, no 16S rDNA gene ampilicons or a negative results were appearing from another animal's Bacteroides (Table 2).

The first set of primers (DF53F and DF606R) successfully showed a single band with dog faecal DNA samples at a product size 572 bp and compared with amplification reactions using DNA of human and animal samples (Table 2 and Figure 2). The second set (DF113F and DF472R) showed no products with all animal faecal DNA samples except a strong positive reaction with dog faecal DNA at product size 379 bp (Table 2 and Figure 3). However, PCR amplification reactions using the third set (DF418 and DF609R) showed a strong positive band with dog faecal DNA at product size 210 bp and weak bands were seen with human faecal DNA and negative results were found with all other animal faecal DNA samples (Table 2 and Figure 4).

572bp

Figure 2: DF53F and DF606R primers amplified with the DNA of Bacteroides from animal faecal samples at product size 572bp.

379bp

Figure 3: DF113F coupled with DF472R primers and amplified with the DNA of Bacteroides from animal faecal samples at product size 379bp.

210bp

Figure 4: DF418F coupled with DF609R primers and amplified with the DNA of Bacteroides from animal faecal samples at product size 210 bp.

Table : The PCR amplification of dog-specific primers with different faecal samples

DNA of animal faeces

Primers

dog

human

cow

horse

pig

sheep

deer

cat

DF53F

+-------

DF113F

+-------

DF418F

+±*------

±* weak reaction

3-3: Phylogenetic tree

The PCR products of the product from amplification reactions of DNA samples isolated from dogs and other animals were sequenced and the sequence analysis using the blast-NCBI software showed significant homology to 16S rDNA gene of Bacteroides. Phylogenetic analysis of Bacteroides based upon the neighbour-joining of partial 16S rDNA showed that sequences were derived from Bacteroides different animals (Figure 5). In addition, the sequences investigation of Bacteroides faecal origin showed a similarity of identity (84 to 89%) to the 16S rDNA of known dog-specific Bacteroides (Table 3). The mismatch effect of primer sequences of dog-specific Bacteroides were investigated with other Bacteroides sequences from different sources, DF53F showed 3-5 oligonucleotides, DF113F showed 7-11 oligonucleotide mismatches with all tested sequences, and DF418F showed 1-4 oligonucleotides mismatches. To determine the effect of the primer mismatch, 16S rDNA genes were amplified by PCR using different primer sets, and sequences were checked again by sequencing which confirmed the sequences.

Figure 5: Phylogenetic tree is showing the evolutionary relationships of host-specific-Bacteroides in the related animals

Table : The maximum similarity of Bacteroides sequences between dog-specific and other host-specific Bacteroides spp.

Sequence name

Length bp

Sequence name

Length bp

Similarity %

dog

639

human

696

89.0

cow

690

87.0

pig

694

84.0

duck

628

84.0

sheep

694

88.0

4: Discussion

The aim of this study was to read the 16S gene sequence of dog specific Bacteroides and to design specific primers differentiating Bacteroides species. Dog-specific primers may be used to investigate and to detect bacterial bathing water contamination on beaches where dogs are present in limited. To our knowledge no dog-specific Bacteroides genome has been sequenced at the time of primer design therefore; three sets primers were selected based on the prevalence of community of dogs in the environmental area. The ability to spread the bacteria with the shed of faeces and the rainfall water can carry it to the bathing water. The following criteria should be considered for designing specific primers, (i) the mismatching between the nucleotides with related species, (ii) a need for less than 50% G+C (iii) avoid sequence complementarities in a primer set (iv) the size of the primer should be between 18-22 nucleotides and (v) avoid secondary structure (Heilig et al., 2002, Chen et al., 2003, Grunenwald, 2003, Shanks et al., 2012).

Samples of dog faeces were collected from different sites in the southwest region of the UK on which this study focused. There is not enough current information available about the 16S gene of the dog Bacteroides which allows design specific primers detecting the dog Bacteroides amongst other animals. This study therefore has used Bacteroides generic primer set previously published (Bernhard and Field, 2000b) to amplify the 16S gene from Bacteroides genomic DNA purified from dog faeces. The results have shown single band appeared at molecular product size at 676 bp compare to the control ladder revealing a preliminary existence of Bacteroides in the collected samples (Figure 1). The sequences results confirmed 638 bp (accession number: EU381168) resulting from the PCR amplification and the blast results confirmed that this applicant is 16S gene of Bacteroides. Generic Bacteroides primers have been used extensively in the classification of Bacteroides amongst other unculturable bacteria and the amplicon size and sequences of the conserved 16S gene are very informative parameters have been used in the species phylogentic studies (Wang et al., 2002). The sequence of 16S gene amplicons of the dog's Bacteroides amplified by the generic primers was aligned with 16S gene of Bacteroides from other animals in order to detect region(s) with strong mismatch sequences, which can be used to design primers specific for the dog's Bacteroides. The results showed that the regions occurring on the nucleotides (53-71, 113-132 and 418-438 bp) also showed mismatches differentiating dog's Bacteroides from other animals. It is well known that the number of mismatched nucleotides, affecting primer annealing temperatures and the DNA regions with high number of mismatches is used to design specific primers and that can be used for many purposes such as phylogenetic analysis to differentiate different species , gene expression, southern blotting . However in case of the current study the aim was to design specific primers of the 16S gene using conventional PCR to distinguish Bacteroides of dog faeces from other types of animal Bacteroides colonizing same environment which is very hard as the 16S gene of Bacteroides species has strong homology (95-98%) and primer for particular species cross react other Bacteroides (Shelburne et al., 2002). Target microorganisms with 1-11 mismatches between two sequences of set and the corresponding regions of 16S rDNA gene sequences were investigated, and from the results, all three sets appeared a high specificity (100%) with dog-specific Bacteroides and no amplification with others except DF418F showed weak reaction with human Bacteroides. That is, these primers detected the Bacteroides from the dog in the environmental samples used. However, other techniques such as DGGE, Real-time PCR and Pyro-sequencing have been used recently to distinguish sequences in closely similar species (Kuboniwa et al., 2010, Denecke et al., 2012).

In this study three sets of primers (DF53F coupled with DF606R, DF113F coupled with DF472R and DF418F coupled with DF609R) were designed for the 16S rDNA gene Bacteroides depending on the mismatch between 16S gene Bacteroides of dog from those of other animals. The results showed that the set (DF53F coupled with DF606R, DF113F coupled with DF472R) successfully produced distinctive single bands with molecular size 572, 379 bp respectively at 60 °C annealing temperature (Figure 2, 3). The sequence results confirmed the 16S gene (accession numbers: JX431865, JX431866 and JX431867) of Bacteroides; whereas both sets produced no reaction with Bacteroides DNA samples from other animals suggesting these primers as dog specific Bacteroides. However, the third set has shown to cross react with 16S rDNA gene from human Bacteroides. The specificity of these primers was examined by performing PCR on Bacteroides DNA from other sources. This resulted in the formation of specific amplicons for Bacteroides spp. The effectiveness of the primers was confirmed during a comparison of the diversity of Bacteroides from a variety of animal faecal samples amplified with the DF53F coupled with DF606R, DF113F coupled with DF472R and DF418F coupled with DF609R primers. For classifying microorganisms in numerous environments, the 16S rDNA genetic marker has been used for phylogenetic quantification. The presence of both variable and conserved regions in 16S rDNA gene is important because giving it the flexibility to be used in microbial community studies (Adékambi et al., 2009, Perumbakkam and Craig, 2011). Yu et al. (2005) reported that specificity is very important to determine the false positive and false negative result of primer.

In our future studies, these primers can be used to monitor the contamination of bathing water and sediment with the Bacteroides from dog faeces and may be used in real time expression to quantify the dog Bacteroides in a particular environment from other sources.

Article name: The Detection Of Bacteroides Spp Biology essay, research paper, dissertation