Chalcone synthase
CHAPTER 1INTRODUCTION1.1 Chalcone synthase
Chalcone synthase [CHS; malonyl-CoA: 4-coumaroyl-CoA malonyltransferase (cyclizing), EC 2.3.1.74] is a key enzyme in the biosynthesis of flavonoid antimicrobial phytoalexins and anthocyanin pigments in plants. CHS supplies 4,2',4',6'-tetrahydroxychalcone to downstream enzymes that synthesize a diverse set of flavonoid phytoalexins and anthocyanin pigments (Jean-Luc, 1999). It catalyzes the stepwise reaction of three acetate residues from malonyl-CoA with 4-coumaroyl-CoA to yield the intermediate naringenin-chalcone (Hans et al., 1986).
CHS genes, or cDNA copies of these genes, have been cloned, sequenced and characterized from several plant species including Antirrhinum majus, Zea mays, Petunia hybrida, Petroselinum hortense, and Phaseolus vulgaris, Sorghum bicolor, Bromheadia finlaysoniana, Arabidopsis, Mattthiola, snowdragon, maize, parsley, bean, leguminous species and pines (Arjula et al., 1996; Yongzhen et al., 2005). The chs genes are structurally conserved and most of them contain one intron and two exons and the cloned chs genes are belong to small multi-gene family (Yongzhen et al., 2005).
The chalcone synthase genes present a high degree of sequence similarity at the amino acid level and have been the object of numerous studies in dicotyledonous plants, where up to seven copies have been identified in several species (Mary et al., 2000). In the monocotyledonous, most of the genera studied (i.e. Zea, Oryza, Hordeum and Secale) have two copies of the chalcone synthase gene (Miriam et al., 2001), although seven copies have been identified in Sorghum bicolor by Lo and Nicholson (1999) (Miriam et al., 2001).
A rice cDNA clone, Os-chs cDNA, encoding chalcone synthase, isolated from a leaf cDNA library of an indica rice variety Purpleputtu has been mapped to the centromeric region of chromosome 11 of rice. Genetic analysis of purple pigmentation in two rice lines, Abhaya and Shyamala, used in the present mapping studies, indicated the involvement of three genes, one of which has been identified as a dominant inhibitor of leaf pigmentation. The Os-chs cDNA shows extensive sequence homology, both for DNA and protein (deduced), to that of maize, barley and also to different monocots and dicots (Arjula et al., 1996).
CHS has been shown to be under a complex system of regulation, and a number of potential regulatory elements have been identified. CHS activity was first described in 1972 in extracts of parsley (Petroselinum crispum) in the group of researchers in Freiburg (Kreuzaler et al., 1972). The enzyme was first labelled as flavanone synthase, because the chalcone was so quickly converted to the flavanone in a non-enzymatic reaction that was not detectable as the initial product. It was corrected a few years later with improved techniques, even though the wrong name was used in the publications up to that time.
In many plants, expression of the chs gene is tigthly regulated in a tissue-specific manner and the enzyme can be induced by the phytochrome system, UV-light or elicitors. These properties make the gene an attractive system for studying the various modes of regulation of gene expression in plants (Hans et al., 1986). For example, in darkgrown parsley (Petroselinum crispum) cell suspension cultures, irradiation with UV light or UV containing white light leads to a massive increase in CHS transcriptional activity 2-4 h after the onset of treatment (Paul et al., 1989).
1.2 ObjectivesLimited studies have been carried on gene expression in bananas and little work has been published on the flavanoid pathways or their related genes in this plant. Cultivated Bananas are normally sterile and seedless while their wild counterparts are fertile. A previous study (Foo, 2009) had analyzed CHS gene sequences from different bananas and shown differences in their sequence. This research focused on studying the differential gene expression levels of chalcone synthase (CHS) between wild type (AA) and cultivated (AA) bananas. The objectives of this study were:
1. To extract and analyse the total RNA from both wild type seeded banana (Musa acuminata ssp malaacencis AA) and unseeded cultivated banana, Mas (AA) by using a CTAB (modified) method.
2. To study the differential expression levels of the chalcone synthase genes in the seeded and unseeded banana by using real-time PCR.
3. To study the correlation if any between differences in chalcone synthase gene expression and parthenocarpy in banana.
CHAPTER 2LITERATURE REVIEW2.1 FlavonoidsFlavonoids are biologically major and chemically diverse group of secondary metabolites that can be divided into subgroups including anthocyanidins, flavonols, flavones, flavanols, flavanones, chalcones, dihydrochalcones and dihydroflavonols, Isoflavonoids and pterocarpanes may also be included. Flavonoids are very important for the pigmentation of flowers and, hence, act as attractants to pollinator and have many functions in plants. Flavonoids also play an important role in protection against UV light, plant pathogen defense induction of nodulation, auxin transport, pollen function, and insect resistance. The diversity in flower color is almost certainly due to differences in either the structural or the regulatory genes of the flavonoid biosynthetic pathway (Tsukasa, 2000).
In general, plants possess the biosynthetic ability of the flavonoids and not animals and fungi, except marine coral. Flavonoids can be divided into several classes, such as anthocyanins, flavones, flavonols, flavanones, dihydroflavonols, chalcones, aurones, flavonons, flavan and proanthocyanidins, isoflavonoids, biflavonoids, etc. Moreover, numerous flavonoid compounds occur in plants by additional hydroxyl, methoxyl, methyl and/or glycosyl substitution patterns. Occasionally, aromatic and aliphatic acids, sulfate, prenyl, methylenedioxyl or isoprenyl groups also attach to the flavonoid nucleus and their glycosides.
2.3. Flavonoid biosynthesis pathway. PAL: Phenylalanine ammonia-lyase; C4H: cinnamate-4-hydroxylase; 4CL: 4-coumaroyl:CoA-ligase; CHS: chalcone synthase; CHI: chalcone isomerase; FSI: flavone synthase; FSII: cytochrome P450 flavone synthase; IFS: cytochrome P450 isoflavone synthase; FHT: flavanone 3β-hydroxylase; DFR: dihydroflavonol 4-reductase; LAR: leucoanthocyanidin synthase; ANS: anthocyanidin synthase; 3GT: UDPG-flavonoid 3-O-glucosyl transferase. Red text indicates cytochrome P450 enzymes.
(adapted from Chemler et al., Microbial Cell Factories 2006, 5:20).
Moreover, more than 4,000 kinds of flavonoids have been reported as naturally occurring compounds. In most cases, the flavonoids are present as glycosides in vacuoles of flowers, leaves, stems or roots. Flavonoid aglycones, and polymethylated flavonoids, were reported as farinose exudates or wax on the leaves, barks and buds, or crystals in the cells of cacti (Tsukasa, 2000). Among the large number of phenolic phytoalexins, isoflavonoids, phenylpropanoids and simple phenolics are well elucidated, whereas the role of flavonoids in defence is less popular, except the catechins and proanthocyanidins (Dieter, 2006).
Moreover, they possess a wide range of biological activities and one of them is their contribution to human health which has made them prominent in the past 10 years. Many flavonoids are active principles of medicinal plants and exhibit pharmacological effects (Dieter, 2006). In general, they are also beneficial for the plant itself as physiological active compounds, as stress protecting agents, as attractants or as feeding deterrents, and by their significant role in plant resistance.
According to the literature reviews, flavonoids belong to a group of natural substances and are found in fruit, vegetables, grains, bark, roots, stems, flowers, tea, and wine. Before flavonoids were isolated as the effective compounds, these natural products were known for their beneficial effects on health. More than 4000 varieties of flavonoids have been identified and an important effect of flavonoids is the scavenging of oxygen- derived free radicals. In vitro experimental systems also showed that flavonoids possess antiinflammatory, antiallergic, antiviral, and anticarcinogenic properties (Robert, 2001).
2.2 Chalcone Synthase in PlantsCHS is the entry point into flavonoid biosynthesis, and the genes are under complex regulation. An important development was the first report on a crystal structure, from the CHS of Medicago sativa, in the group of J. Noel (Jean-Lac, 1999). 2-Pyrone synthase (2-PS) and chalcone synthase (CHS) are plant-specific PKSs that exhibit 74% amino acid identity. 2-PS and CHS share a common three-dimensional fold, a set of conserved catalytic residues, and similar CoA binding sites.
The structure of CHS complexed with resveratrol can be considered how stilbene synthase, a related enzyme, uses the same substrates and an alternate cyclization pathway to form resveratrol. By using the three-dimensional structure and the large database of CHS-like sequences, can identify proteins likely to possess novel substrate and product specificity (Jean-Lac, 1999). In grapes and red wine, a plant phenolic compound, resveratrol is found but is not widely distributed in other common food sources. There is no resveratrol synthase in tomato, the precursor molecules are all present and used by chalcone synthase (CHS), the key enzyme of flavonoid biosynthesis (Ingrosso et al., 2009).
The structure provides a framework for engineering CHS-like enzymes to produce new products and elucidates the chemical basis of plant polyketide biosynthesis. Chalcone synthase (CHS) operates early in the biosynthetic pathway of flavonoids, secondary metabolites which play important roles in the interactions which occur between plants and their environment (Miriam et al., 2001).
Several reports showed that Chalcone synthase plays essential role in the biosynthesis of plant phenylpropanoids. The plant phenylpropanoid pathway provides anthocyanins used for pigmentation and protection against UV photodamage, antimicrobial phytoalexins and flavonoid inducers of Rhizobium nodulation genes. The phenylpropanoids exhibit cancer chemopreventive, antimitotic, estrogenic, antimalarial, antioxidant and antiasthmatic activities as medicinal natural products (Rhonda et al., 1988).
The accumulation of flavone, flavonol, and isoflavonoid compounds in response to UV light and pathogen stress has been shown to be due to an increase in the rate of transcription of the Chalcone synthase (CHS) gene, which encodes the first enzyme unique to flavonoid biosynthesis, and other flavonoid biosynthetic genes (Rhonda et al., 1988). The accumulation of anthocyanins in response to specific environmental conditions might also be due to transcriptional regulation of CHS and other genes in the biosynthetic pathway.
Peters et al., (1986) have shown that this chalcone synthase is involved in pigment formation, symbiosis, and plant defenses against pathogen attack and exposure to ultra-violet light. This enzyme is well-conserved among plants of different groups, and that it has a cysteine residue at amino acid 169 that is thought to be part of the 4-coumaroyl-CoA binding site and which is required for enzyme activity (Miriam et al., 2001). Mary et al. (2000) have pointed out that chalcone synthase is suitable for
studies of gene duplication and investigations on the origin of gene families. The chalcone synthase group 1 is the well-conserved chalcone synthase found in plants and is highly homologous to sorghum chalcone synthases (Miriam et al., 2001).
Most of the researchers focused on the promoter region of the chalcone synthase (CHS) gene because it is among the best-characterized promoters in plants and its expression is induced by multiple cues. Among those cues, light and insect herbivores were shown to upregulate CHS expression in A. thaliana (Juliette et al., 2006). In addition, CHS is the branch-point enzyme of a pathway involved in the interaction between plants and their abiotic and biotic environments, hence this gene is likely to play a role in adaptive evolution. However, patterns of nucleotide variation in the A. thaliana CHS promoter showed no evidence of non-neutral evolution in this inbreeding annual species (Juliette et al., 2006).
In petunia, CHS comprises a multigene family in which only one gene is expressed to high levels in petal tissue (Ronald et al., 1989). In maize, CHS has been shown to be rate limiting for anthocyanin production, although it is not limiting in Antirrhinum. The flower patterns were elicited by the CHS transgene often vary among the flowers of a single plant. The phenotypes with an antisense CHS gene were not same as the sense phenotypes either in the degree of pigment reduction or in the nature of the patterns. The sense transgene affected all pigmented floral parts (corolla limbs, corolla tubes, and anthers), as well as stems and leaves, whereas the antisense transgene affected only the limbs of the flower corolla (Carolyn, 1990).
The dancer and wedge class patterns, which are characteristic of CHS sense transgenotes, have never been seen in antisense flowers (Carolyn, 1990). There are, however, a number of examples of similar allelic interactions that could be related mechanistically to co-suppression. One example is at the CHS-encoding nivea locus in Antirrhinum majus in which a semi-dominant allele is able to inhibit the expression of the wild-type allele in trans. This effect at the Antirrhinum CHS locus, taken together with the petunia CHS co-suppression effect, suggests that it would be worthwhile to investigate the basis of another dominant CHS allele, the C2-ldf allele in maize (Carolyn, 1990).
Ubiquitous plant natural products are flavonoids that include visible pigments (anthocyanins and chalcones), as well as colorless UV-absorbing compounds (flavonols, flavonones, and flavones) The first step in flavonoid production is catalyzed by CHS in petunia as well as in maize. Recently, Agrobacterium-mediated introduction of a CHS transgene into a pigmented inbred petunia stock was reported to suppress the expression of the endogenous CHS gene(s), resulting in flower corollas completely lacking flavonoid pigmentation (Napoli et al., 1990) because the expression of the CHS transgene is also suppressed in these plants. The integrated transgene acts like an unlinked dominant inhibitor of the endogenous CHS gene(s) and leads to a complete block in the production of visible flavonoid pigments not only in flower petals but also in reproductive organs (Taylor et al., 1992).
In bean (Phaseolus vulgaris L.) and other members of the Leguminoseae, chalcone synthase is also involved in the synthesis of the isoflavonoid- derived phytoalexin antibiotics characteristic of this family (Thomas et al., 1987). The haploid genome of bean contains a family of about six to eight CHS genes, some of which are tightly clustered. Treatment of bean cells with fungal elicitor activates several of these genes leading to the accumulation of at least five and probably as many as nine distinct CHS transcripts encoding a set of CHS isopolypeptides of Mr 42-43 kDa but with differing pH in the range of pH 6-7 (Thomas et al., 1987).
Moreover, in bean (Phaseolus vulgaris L.) and other members of the Leguminoseae, CHS serves a dual function since the enzyme is also involved in the synthesis, in response to wounding and infection, of the isoflavonoid-derived phytoalexins which are characteristic of, and specific to, legumes. cDNA clones containing sequences complementary to CHS mRNA from irradiated cells and cells treated with fungal elicitor have been identified. They have been used to demonstrate that these stimuli activate transcription of CHS genes leading to increased mRNA and enzyme levels and hence accumulation of flavonoid pigments and isoflavonoid phytoalexins respectively (Thomas et al., 1987).
The efficacy of the ihp construct was tested in strawberry fruits by targeting the pigment biosynthesis gene chalcone synthase (CHS) that is involved in the biosynthesis of the major anthocyanins in strawberry fruit. CHS was chosen as the reporter gene because reduction of the CHS function using antisense technology leads immediately to the loss of pigmentation in flowers and fruit, and is thus easily detected. As a consequence of the reduced activity of CHS in strawberry plants transformed with an antisense CHS gene construct, the levels of anthocyanins, flavonols and proanthocyanidins were downregulated in the fruit and precursors of the flavonoid pathway were shunted to the phenylpropanoid pathway (Thomas et al., 2006).
The expression of the CHS gene in fruit tissue is reported to be developmentally regulated and associated with fruit colouring and this has been shown in Rubus, apple, bilberry, grapevine and strawberry. The phenomenon of cosuppression of homologous genes was first described in petunia, where the introduction of an additional CHS gene resulted unexpectedly in plants with totally white flowers. Additionally, Arabidopsis plants transformed with a CHS-ihpRNA construct showed pronounced silencing resulting in the reduced production of flavonoid pigments (Thomas et al., 2006).
CHS has been shown to be regulated transcriptionally in response to two environmental signals, UV light (in P. hortense and A. majus) and fungal pathogen treatment. High-intensity light conditions, which induce the accumulation of anthocyanin pigments in the leaves and stems of A. thaliana plants, cause a concomitant increase in the level of CHS enzyme activity. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time (Rhonda et al., 1988).
A basal expression level for chs genes in a tissue-specific manner in pigmented flowers and roots can be elevated by developmental and environmental cues such as infection by microbial pathogens, UV light, wounding and treatments with kinds of elicitiors. For example, chs gene from Ginkgo biloba, the expression of Gbchs gene increased during UV-B and wounding treatments which might due to an acute needs for extra pigments in terms of protection from UV or defensive phenolics in response to wounding. In addition, the activities of chs genes were reported to be largely regulated at transcription level. For example, chs genes from Petroselinum crispum and A. thaliana contained ACGT-containing G-box in their promoter regions, which was identified as light-responsive elements (Yongzhen et al., 2005).
2.3 BananaBanana (Musa), a monocot plant in the family Musaceae originated in South and Southeast Asia, has played interesting and important roles in the history of human civilizations and also constitute a crucial part of human diets in all tropical regions. Banana has evolved in this region, has been introduced and developed until the recent time in both primary and secondary loci of genetic diversity such as Africa, Latin America, and the Pacific (Pongsagon, 2008).
Banana plant is the source of food, beverages, fermentable sugars, medicines, flavoring, silages, fragrances, ropes, clothing, smoking materials, and numerous ceremonial and religious uses (Pongsagon, 2008). Bananas are very rich in carbohydrates, vitamin C (also A and some B vitamins), and several important minerals, including potassium, phosphorus, copper, magnesium, calcium, and iron.
However, the literature reviews showed that botany, cytology, breeding, horticulture, physiology, biochemistry, nutritional and therapeutic value of banana had been already studied in depth (Nor Adlin, 2008). According to Maud Grieve (1931), the respected herbalist, revealed that the banana family is more of interest for its nutrient than for its medicinal properties. Each banana contains 74% water, 23% carbohydrates, 2.6% fiber, 1% proteins and 0.5% fat (these values vary between different banana cultivars, degree of ripeness and growing conditions) (Nor Adlin, 2008).
2.4 Taxonomy and Classification of BananaKingdom : Plantae
Division : Magnoliophyta
Class : Liliopsida
Order : Zingiberales Zingiberacea
Family : Musaceae
Genus : Musa
Banana is a monocotyledonous plant of the family Musaceae, which is composed of the three genera i.e., Ensete, Musa and Musella. The genus Musa is comprised of 30-40 species and is divided into five sections; Eumusa, Rhodochlamys, Ingentimusa, Australimusa, and Callimusaa according to the basic haploid chromosome numbers. Australimusa, and Callimusaa comprised of about six species each, possess a basic chromosome number of X=10, while Musa and Rhodochlamys contained about 15 and 6 species, respectively, possess that of X=11. Musa ingens is the only member in the section of Ingentimusa with X=7 (Kasipong, 2008).
2.4.1 Acuminata cultivars (AA Genome, seeded)1. Pisang Kra
2. Pisang Segun
3. Pisang Flava
4. Pisang Sintok
5. Pisang Surong
6. Pisang Rangis
7. Musa acuminata malaccensis (Lenggeng)
2.4.2 Acuminata cultivars (AA Genome, edible)1. Pisang Mas/ Pisang Mas Besar/ Pisang Mas Kampong/ Pisang Mas Air/ Pisang Minyak (Kluai Kangsar)
2. Pisang Mas Sagura/ Pisang Perak
3. Pisang Lemak Manis Kelantan/ Pisang Lemak Manis Terengganu/ Pisang Lemak Manis (Raub)/ Pisang Lemak Manis (Lipis)/ Mas Pahang
4. Pisang 40 Hari/ Pisang 40 Hari (Sabah)/ Pisang Boyan/ Pisang Bulin/ Pisang Mas Kertas
5. Pisang Kapas/ Pisang Kapas (Pontian)/ Pisang Kapas (Pisang Aur)/ Pisang Pota (Pisang Aur)/ Pisang Putar (Ulu Terengganu)/ Pisang Lemak Manis Pahang
6. Pisang Berangan/ Pisang Berangan I/ Pisang Berangan II/ Pisang Jelai Berangan/Pisang Berangan Besi/ Pisang Berangan Buaya/ Lakatan (Philippines)
7. Pisang Nur (Kluai Krai)
8. Pisang Lilin
9. Pisang Jari Buaya/ Pisang Lidah Buaya/ Pisang Rotan
10. Pisang Ekor Kuda/ Pisang Kuda
11. Pisang Masam
12. Pisang Jarum/ Pisang Jarum (Perlis)
13. Pisang Raksa/ Raksa (Pisang Tioman)
14. Pisang Keladi/ Pisang Pinang/ Pisang Ulat
15. Pisang Serindik/ Gu Nin Chio/ Gu Chi Nio
2.5 Banana GenomeAlthough the nuclear genome of banana (Musa spp.) is relatively small (1C ~ 610 Mbp for M. acuminata), the results obtained from other sequenced genomes suggest that more than half of the banana genome may be composed of repetitive and non-coding DNA sequences. Knowledge of repetitive DNA can facilitate mapping of important traits, phylogenetic studies, BAC-based physical mapping, and genome sequencing/annotation. However, only a few repetitive DNA sequences have been characterized in banana (Hrcaronibová et al., 2007).
2.5.1 Genome SizeThe nuclear genome of Musa was found to be small with the A genome (M. acuminate) being larger than the B genome (M. balbisiana). The results suggested that genome size might be used to discriminate both genomes. Lysák et al., (2000) demonstrated that the B genome is smaller by 12% on average using a larger set of diploids.
Among the accessions of M. balbisiana, no intraspecific variation of genome size was found with an average size of 537 Mbp. On the other hand, the genome size is small but statistically significant variation (591-615 Mbp) was found among the subspecies and clones of M. acuminata. The distinct areas of origin of individual accessions of M. acuminata may be reflected by the differences and may be due to variation in the copy number of repetitive DNA sequences (Doleel, J., 2004).
2.5.2 Genome ConstitutionGenomic constitution in Musa has traditionally been determined from morphological parameters. Nuclear DNA content may be used to predict genomic constitution according to Lysák et al., (2000). However, the differences among individual A and B genomes, and/or the involvement of other Musa genomes may compromise the interpretation of flow cytometric data. Where labelled genomic DNA is used as a probe, a powerful alternative approach involves genomic in situ hybridisation (GISH). The potential of GISH for Musa was first to demonstrate by Julian et al., 1997.
The researchers were able to discriminate between chromosomes of A-genome and B-genome origin in cultivated clones and artificial hybrids, although substantial cross-hybridisation between A and B genome DNA was observed (Doleel, J., 2004). Subsequently, Dhonta et al., (2000) revealed that the method might also be used to discriminate chromosomes representing the S (M. schizocarpa) and the T (M. textilis) genomes. Musa spp., in cultivated banana, there are four known genomes, A, B, S, and T. These genomes correspond to the genetic constitutions of wild Eumusa species M. acuminata, M. balbisiana, M. schizocarpa, M.textilis and the Australimusa species, respectively.
Most cultivated clones have been classified into genomic groups according to chromosome numbers and morphological traits, and are triploid or diploid (Dhonta et al., 2000). The chromosomes of these four genomes can be differentiated by genome in stiu hybridization (GISH); however, a distal portion of the chromosomes remained unlabelled. GISH was used to determine the exact genome structure of interspecific cultivated clones but it cannot identify the inter-genomic chromosome translocation.
The clone 'Pelipita' has the 8-A and 25-B chromosomes instead of the predicted 1-A and 22-B which is the notable exception. The chromosome complement of a few clones can be determined using GISH. The researchers revealed that rDNA sites were located in Musa species. They appeared to be often associated with satellites, which can be separated from the chromosomes, representing a potential source of error for chromosome counting using classical techniques (Dhonta et al., 2000).
2.5.3 Chromosome StructureThe structure of Musa chromosomes has been known a little, most of the information comes from the studies on chromosome pairing during meiosis. Local wild seeded species and subspecies were found to show regular chromosome pairing with 11 bivalents, indicating the absence of detectable structural heterozygosity. On the other hand, diploid parthenocarpic clones showed aberrant chromosome pairing with univalents, trivalents, and multivalents, indicating heterozygosity for one or more translocations or inversions (Doleel, J., 2004).
2.6 Banana Variation and CultivarsEdible bananas are classified into several main groups and subgroups. The diploid M. acuminata group 'Sucrier' has been placed in first by Simmonds, represented in Malaysia, Indonesia, Philippines, southern India, East Africa, Burma, Thailand, the West Indies, Colombia and Brazil. The leaves are yellowish, the sheaths dark-brown and nearly free of wax. Bunches are small and the fruits small, thin-skinned and sweet.
Cultivated bananas (Musa spp.) are often listed in botanical references as Musa x paradisiaca (Musaceae), mostly diploid or triploid cultivars combinations of the A and B genomes inherited from their diploid ancestors Musa acuminata Colla and Musa balbisiana Colla. The identification of Musa cultivars has traditionally been based upon various combinations of morphological, phenological and floral criteria. The combination of genome, for example ABB and ABBB occur naturally or are produced by artificial hybridization (Pillay et al., 2000). The taxonomy of cultivated bananas has long been a contentious issue and it relies heavily on morphology (Brown, 2009).
2.6.1 Pisang MasPisang mas ( Musa acuminata Colla (AA group) ) is favored most among all the local dessert bananas because of its fascinating golden peel and yellow pulp, good aroma as well as sweet taste. It is a native Malaysian banana known as "pisang mas" in Malay, which has the translation of "golden banana" (pisang = banana, mas = golden).
2.6.2 Wild TypeThe two genera, Musa and Ensete, of which Musa encompasses wild and domesticated bananas and plantains. Domesticated bananas are parthenorcarpic and generally seedless. Seeded Musa acuminata (Genome AA) became the progenitor of parthenorcarpic AA diploid clones and of AAA triploids. The great bananas of international commerce (Cavendish) are an AAA triploid derived from pure Musa acuminata.
The main domestication of pure acuminata types was probably found in Malaysia and neighbouring islands and areas as far east as the Indo-Chinese peninsula (Farmer's knowledge of wild Musa in India). The majority of domesticated bananas, however, are of hybrid origin between Musa acuminata and the other major wild species in Eumusa, Musa balbisiana (Genome BB). They are either AB, AAB, or ABB in genomic terms. The key mutation required to convert wild banana fruit into readily consumable fruit was parthenorcarpic.
This trait is governed by one or a few genes and it enables the fruit to fill with pulp even in the absence of pollination. This is different from seedlessness, which is governed by other genes, or induced by triploidization. Parthenorcarpic must have occurred many times in Musa acuminata which gradually became less seedy as other mutations occurred for seedlessness or as triploids occurred naturally (Farmer's knowledge of wild Musa in India).
2.7 FruitingFruiting exacts a huge energy toll from the mother plant that needs a lot of nitrogen and moisture to sustain it. After a stalk of bananas has developed, it may be 6 to 7 months before the fingers are mature. The fruits ("fingers") are formed in layers called combs or hands, each hand has a crown to which 10 to 20 fingers are attached and there are 6-15 combs per stalk, which equals 40-50 kilograms per stalk or ten or more tons per acre per year.
The fruits are attached to the peduncle by pedicles. The sum of fruits in the inflorescence is known as the bunch, individual cluster of fruits is known as hand, and individual fruit is called finger (Nor Adlin, 2008). Morphology of the developing banana fruits both seeded and parthenorcarpic varieties were already studied (Tripathil, 2003). Peel cells consist of an outer cuticle and epidermis, several layers of hypodermal parenchyma and parenchyma cells interspersed with latex vessels, vascular bundles, and air spaces.
In addition, the hydrodermal cells and the innermost pulp - initiating cells tend to be smaller and more tightly packed than the other cells. Pulp cells consist of a large numbers of starch grains in mature, pre-climacteric tissue. During ripening, the pulp cells become progressively depleted of starch and individual cells can be revealed in details. An unripened banana has high starch and low sugar levels plus copious amounts of bitter-tasting latex. Starch is converted to sugar as the fruit ripens, so that bananas can eventually have about 25% sugar.
The latex is also broken down, as the banana ripens. This study also reveals the significance contribution of the peel to the overall metabolism of the banana fruit. Large proportion of peel tissue makes up about 80%, 40% and 33% of the fresh weight of juvenile, mature and fully ripe fruit, respectively. According to Espino et al., (1992) as the fruit grow, the pulp/skin ratio will rise steadily. Presence of naturally formed ethylene gas, produced by ripen fruits, hastens the ripening of surrounding, greener fruits, which is enabled to speed the yellowing of green fruits. Ethylene gas can be used commercially to cause green bananas to start ripening (Nor Adlin, 2008).
The fruit of a banana is a berry with a leathery outer peel that contains much collenchyma. Among the edible bananas, the only important diploid of M. acuminatais 'Sucrier' which fruit is sweet and thin-skinned. The major triploid bananas, 'Gros Michel' or cultivars derived from "Cavendish" stock that is shipped. In Central America, 'Gros Michel' and 'Poyo' Cavendish were wiped out virtually overnight by Panama disease, a fungus (Fusarium oxysporium cubense), which attacks the phloem. Fortunately, some banana clones showed resistance in the field, and growers reestablished plantations with those plants (Tripathil, 2003).
Nowadays, the Jamaican clone 'Valery' (a robust Cavendish banana) is grown widely in Central America, because it is resistant to Panama disease. M. balbisiana Colla of southern Asia and the East Indies bears a seedy fruit but the plant is valued for its disease-resistance and therefore plays an important role as a "parent" in the breeding of edible bananas. The fruit (technically a "berry") turns from deep-green to yellow or red, or, in some forms, green-and white-striped, and may range from 2.5 to 12 in (6.4-30 cm) in length and 3/4 to 2 in (1.9-5 cm) in width, and from oblong, cylindrical and blunt to pronouncedly 3-angled, somewhat curved and hornlike (Morton, 1987).
The flesh, ivory-white to yellow or salmon-yellow, may be firm, astringent, even gummy with latex, when unripe, turning tender and slippery, or soft and mellow or rather dry and mealy or starchy when ripe. The flavor may be mild and sweet or subacid with a distinct apple tone. Wild types may be nearly filled with black, hard, rounded or angled seeds 1/8 to 5/8 in (3-16 mm) wide and have scant flesh. The common cultivated types are generally seedless with just minute vestiges of ovules visible as brown specks in the slightly hollow or faintly pithy center, especially when the fruit is overripe. Occasionally, cross-pollination by wild types will result in a number of seeds in a normally seedless variety such as 'Gros Michel', but this has never been reported in the Cavendish type (Morton, 1987).
2.8 ParthenocarpyParthenorcarpic fruits are luck of embryo and endosperm. In nature, such fruits occur with frequency has been a mystery because they do not yield viable offspring and thus do not contribute directly to fitness. In general, nearly twenty percent of the fruit crop can be parthenorcarpic. In botany, the term parthenorcarpic is the development of the ovary of a flower into a fruit formation without fertilization by pollen. Naturally, it may occur spontaneously in some plants, for example, banana and in other plants can be induced by application of auxins. It can also be induced in some fruit crops, either by breeding or by applying certain plant hormones.
The fruits that develop parthenocarpically are typically seedless and therefore do not contribute to the reproduction of the plant, examples are bananas and pineapples (Dhonta et al., 2000). Bananas are parthenocarps and the edible banana is the fruit of a sterile hybrid. The banana plant grows as a series of suckers from a rhizome. Each stem gradually droops downwards and produces at its tip the male flowers, which are sterile. The female flowers produce the edible fruits without fertilization. The plant dies, after a stem has produced a crop of fruit and is replaced by a new stem from a bud further along the rhizome.
A banana plant may live for over 60 years. Some seedless fruits come from sterile triploid plants, with three sets of chromosomes rather than two. The triploid seeds are obtained by crossing a fertile tetraploid (4n) plant with a diploid (2n) plant. The triploid seeds are larger, and both types of seeds are planted in the same vicinity. Male flowers of the diploid plant provide the pollen which pollinates (but does not fertilize) the sterile triploid plant.
Most bananas at local supermarket came from sterile triploid hybrids (Tripathil, 2003). Common cultivated bananas are usually triploid (3n) with three sets of chromosomes. If A represents one haploid set of chromosomes from diploid M. acuminata (AA) and B represents one haploid set of chromosomes from diploid M. balbisiana (BB), then hybrid bananas have three sets of chromosomes represented by AAB, ABB or another 3-letter (triploid) combination of A's and B's.
Cultivated bananas are completely sterile and do not produce mature seeds except aborted ovules inside the fruit that appear like tiny black dots. As literature reviews, bananas are sterile and seedless because one set of chromosomes (A or B) has no homologous set to pair up with during synapsis of meiosis. Therefore normally meiosis does not proceed, and viable gametes (sex cells) are not produced. Banana plants must be propagated vegetatively (asexually) by planting corms, pieces of corms or sucker sprouts without seeds (Tripathil, 2003).
In Musa, the fact that triploid cultivars are seedless, almost sterile and they develop fruit by parthenocarpy but it is also a constraint when it comes to improve their yield and resistance to biotic stresses. Breeders always aim to get parthenocarpic hybrids with enhanced resistance. Simmonds (1959) reported that parthenocarpy is controlled by at least three independent complementary dominant genes (V. Krishnamoorthy, 2004).
The analysis of parthenocarpy and sterility in the edible diploids is the key to understand banana evolution (Rodomiro, 1995). Simmonds pointed out those seedless edible bananas are the product of two evolutionary processes: parthenocarpy and sterility, however, very few genetic markers are available in banana and plantain as a result of a lack of inheritance studies (Rodomiro, 1995). In this experiment, Musa acuminata partial chs gene for putatative chalcone synthase was focused to study the differential expression levels of this gene in wild type and cultivated banana, Mas.
2.9 Influence of Chalcone Synthase gene in BananaThe enzyme, chalcone synthase is pivotal for the formation of seed during the fruit development. The previous study has proved that downregulation of the flavonoid biosynthesis pathway using RNA interference (RNAi)-mediated suppression of chalcone synthase (CHS), the first gene in the flavonoid pathway can cause parthenocarpy of the tomatoes. In CHS RNAi plants, total flavonoid levels, transcript levels of both Chs1 and Chs2, as well as CHS enzyme activity were reduced by up to a few percent of the corresponding wild-type values (Elio et al., 2007).
The resulting transgenic fruits showed a strong decrease of total flavonoid levels and displayed an altered color. Consequently, these fruits were devoid of seeds. In addition to (male) sterility, parthenocarpy, which is defined as the formation of seedless fruits in the absence of functional fertilization (Gustafson, 1942), is a desirable trait for several important crop plants. Unfortunately, mutations causing parthenocarpic fruits as well as plant hormone-based approaches to obtain parthenocarpy often have pleiotropic effects and can result in undesirable characteristics, such as misshapen fruits (Elio et al., 2007).
In some plants, flavonoids, play a crucial role in fertility and sexual reproduction. For example, inhibition of flavonoid production in Petunia plants, through antisense suppression of the gene encoding chalcone synthase (CHS), resulted not only in the inhibition of flower pigmentation but also in male sterility (Van der Meer, 1992). Further evidence for a role of flavonoids in sexual reproduction is provided by the male sterile Petunia white anther (wha) mutant, which could be complemented by the introduction of a functional CHS cDNA (Napoli, 1999). Therefore, mutation of chalcone synthase gene might be related to the formation of parthenocarpic in banana (Elio et al., 2007).
CHAPTER 3MATERIALS AND METHODS3.1 Plant MaterialsTwo species, Pisang Mas, Musa acuminata Colla (AA group) and wild type, Musa acuminata malaccensis were chosen for the experiment. Pisang Mas samples were obtained from Multicore Sdn Bhd, Johor Baru, Malaysia and wild type samples were collected from the vicinity of Palapes, Universiti Malaya, Kuala Lumpur, Malaysia. The leaves, stems, roots, flowers (male bud) and fruits from both Mas and wild type were selected prior to RNA extraction.
Musa species and cultivars have been widely studied by several researchers; however, the potential link between mutations in chalcone synthase gene and parthenocarpy in banana has not studied (Foo, 2009). Therefore, in this experiment, different parts of samples such as leaf, stem, root, flower and fruit from each mature plants were chosen to study the differential gene expression levels of different tissues in banana.
3.2 RNA ExtractionModification of a CTAB method by (Ying, 2002) was used to carry out RNA extraction from both wild type and Mas samples. 15 mL extraction buffer was pre-warmed to 65°C in a water bath by adding 20µl β-mercaptoethanol. 0.4-0.7g of different tissues was ground in a mortar using liquid nitrogen. The frozen powder was quickly transferred to the pre-warmed extraction buffer and mixed completely by inverting the tube. The mixture was incubated at 65°C for 10 min with vigorous shaking several times.
An equal volume of chloroform-isoamylalcohol was added and shaken vigorously. Then the tubes were centrifuged at 10,000 g for 10 min at 4°C. The very viscous supernatant was transferred to a new tube and re-extracted with an equal volume of chloroform-isoamylalcohol. Then, centrifuged as above. The supernatant was collected very slowly and carefully to avoid taking the cell lysates in chloroform. Then, the supernatant was centrifuged at 30,000 g for 20 min at 4°C to precipitate the pellet and discard the insoluble material. 0.25 vol of 10 M LiCl was added to the supernatant, mixed well, and stored at 4°C overnight. The RNA was recovered by means of centrifugation at 30,000 g for 30 min at 4°C. The viscous supernatant was completely discarded and washed the pellet with 75% ethanol 3 times to remove the remaining and air dried it for 10 min. The RNA was dissolved in DEPC-treated water and stored the RNA at -80°C until use.
3.3 RNA AnalysisThe RNA was analyzed using the standard methods for agarose gel electrophoresis (Sambrook et al., 1989). The RNA quantity and quality was further estimated spectrophotometrically by bio photometer, (eppendorf, Germany) at the absorbance ratios of A260/280.
3.4 Gel ElectrophoresisGel electrophoresis is a widely used technique for the analysis of nucleic acids and proteins. Almost every molecular biology research laboratory routinely uses agarose gel electrophoresis for the preparation and analysis of DNA/RNA. Electrophoresis is a method of separating substances based on the rate of movement while under the influence of an electric field.
Agarose is a polysaccharide purified from seaweed. Several factors influence how fast the RNA moves, including the strength of the electrical field, the concentration of agarose in the gel and most importantly, the size of the RNA molecules. Smaller RNA molecules move through the agarose faster than larger molecules. RNA itself is not visible within an agarose gel. The RNA will be visualized by the use of a dye that binds to RNA.
3.4.1 Preparation of 1% Agarose GelThe tank and column were rinsed with 70% ethanol and then washed with TBE which is already diluted into 1X TBE buffer from the 10X TBE buffer stock. 350mg of agarose powder was dissolved in 35ml of 1X TBE and boiled using microwave oven about 1 min. The agarose mixture flask was cooled down under running tap water. 1µl ethidium bromide was added and then poured it into the gel rack and the comb which is inserted into the other side of the gel rack. The comb was removed when the gel was solidified and put into the chamber with 1X TBE.
Then, 2 µl of 100bps DNA ladder was injected into the first well, 2µl of different RNA samples were mixed with loading dye and injected into the second, third and the following wells. During electrophoresis, the gel was submersed in a chamber containing a buffer solution and a positive and negative electrode and the current was applied at 120V for 25 min. The RNA to be analyzed is forced through the pores of the gel by the electrical current. Under an electrical field, RNA will move to the positive electrode (red) and away from the negative electrode (black). Then, the gel was analyzed by using Geldoc AlphaImagerTM 2200, (Alpha Innotech, U.S.A).
3.5 DNase TreatmentAccurate determination of total RNA concentration is particularly important for absolute quantification of mRNA levels where mRNA copy numbers are best normalized against total RNA and any significant DNA contamination will result in inaccurate quantification (Bustin, 2002). Many researchers are reluctant to expose their precious RNA samples to DNase treatment that the residual RNases will degrade it or affect its long-term storage. If precious samples are to be DNase-treated, it is necessary to ensure that the DNase is removed prior to any RT step.
3.5.1 Preparation of RNA sample prior to RT-PCR3µl DNase 1 reaction buffer, 2µl dH2O, and 1mg RNA sample were added to the eppendorf tubes and incubated in room temperature for 15 min. Then, 3µl EDTA (stop solution) was added to each tubes and incubated in water bath for 65 , 10 min. Then, all the DNase treated samples were ready to run the gel electrophoresis.
3.5.2 Deoxyribonuclease 1, Amplification GradeDeoxyribonuclease 1, Amplification Grade (DNAse 1, Amp Grade) was obtained from Invitrogen, UK. It digests single and double-stranded DNA to oligodeoxy-ribonucleotides containing a 5' phosphate. It is suitable for eliminating DNA during critical RNA purification procedures such as those prior to RNA-PCR amplification. DNase 1, Amp Grade is purified from bovine pancreas and has a specific activity of ≥ 10,000 U/mg.
3.6 Reverse transcriptionThe RT step is critical for sensitive and accurate quantification and the amount of cDNA produced by the reverse transcriptase must accurately represent RNA input amounts. The reverse transcriptase enzyme is sensitive to salts, alcohols or phenol remaining from the RNA isolation (Willard et al., 1999). Therefore, the dynamic range, sensitivity and specificity of the enzyme are prime considerations for a successful RT-PCR assay. Protocols using a one tube/one or two enzyme-based approaches are significantly more convenient than those using two tube/two enzyme based protocols but have been reported to be less sensitive (Bustin, 2002).
RT reactions are usually carried out between 40 and 50 and at these low temperatures there can be problems with the relative nonspecificity of the RT reaction (Bustin, 2002). This results in non-specific priming by both forward and reverse primers and is a particular problem with very low concentrations of starting template. This is because such templates can cause the enzyme to stop, dissociate from the RNA template, or skip over looped-out regions of RNA. To test the claim, High Capacity cDNA Reverse Transcription Kit (200 Reactions) was used in this experiment to prepare cDNA from total RNA isolated.
3.7 Reverse transcription - Polymerase Chain Reaction ( RT-PCR )RT-PCR (reverse transcription-polymerase chain reaction) is the most sensitive technique for mRNA detection, quantitation and powerful tool for analyzing RNA. Compared to the two other commonly used techniques for quantifying RNA levels, Northern blot analysis and RNase protection assay, RT-PCR is exquisitely sensitive, permitting analysis of gene expression from very small amounts of RNA even at the level of the content of a single cell (Willard et al., 1999).
In fact, this technique is sensitive enough to enable quantification of RNA from a single cell. RT-PCR may also be used in cloning, constructing a cDNA library, amplifying signal during in situ hybridizations, and synthesizing probes. The first part of the reaction, reverse transciption, synthesizes cDNA from RNA and the second step amplifies the synthesized cDNA to easily detectable levels. DNA primers are specific to the mRNA sequence and the DNA sequence to be amplified and are needed in order for the correct span of DNA to be amplified.
3.7.1 cDNA Reaction PreparationThe High Capacity cDNA Reverse Transcription Kit (200 Reactions) was obtained from Applied Biosystems, USA, contains all components necessary for the quantitative conversion of up to 2µg of total RNA in a single 20µL reaction to single stranded cDNA. The kit includes Random Primers, optimized RT Buffer, dNTP's and MultiScribe™ MuLV reverse transcriptase. Reactions can be scaled up to 100 µL to generate 10 µg of cDNA from a single reaction. The kit contains reagents that when combined from a 2X Reverse Transcription (RT) Master Mix. An equal volume of RNA sample was added and RNase-free reagents and consumables were used to avoid Rnase contamination.
3.7.1.1 Preparation of 2X RT Master Mix (per 20µl reaction)2 X RT Master Mix preparations were carried out by using a typical assay according to the manufacturer's instructions. This is performed in 0.2ml thin-walled PCR tubes, in a final volume of 20µl.
3.7.1.2 Preparation of the cDNA Reverse Transcription reactions10µl of 2 X RT master mixes was pipette into each well of a 96-well reaction plate or individual tube. Then, 10µl of RNA sample was pipette into each well, pipetting up and down two times to mix. The plates or tubes were sealed and briefly centrifuged the plate or tubes to spin down the contents and to eliminate any air bubbles. The plates or tubes were placed on ice until to load the thermal cycler.
3.7.2 cDNA SynthesisThe cDNA synthesis is carried out in the thermo cycler at 25 for 10 min, 37 for 120 min, 85 for 5 min and 4 hold using High Capacity cDNA Reverse Transcription Kit.
3.8 Primer DesignMusa acuminata partial chs gene for putatative chalcone synthase gene sequence is available at the NCBI (National Center for Biotechnology Information) Gene Bank (www.ncbi.nlm.nih.gov). Multiple alignment analysis was done by using ClustalW2 (www.ebi.ac.uk/clustalw). Three sets of primer was designed from Musa acuminata partial chs gene for putative chalcone synthase with accession no. AM259305 using primer 3 software provided by applied biosystem Real-Time 7500 machine.
The primer-designed sequences are as follow:Forward Primer
5' CTCGCCATGTTCCCGTACTC 3'
Reverse Primer
5' AGCGACTGGAACTCCATATTCTG 3'
Forward Primer
5' CGCCATGTTCCCGTACTCTT 3'
Reverse Primer
5' TCAGCGACTGGAACTCCATATTC 3'
Forward Primer
5' TCCACAACGACGGATATCAATG 3'
Reverse Primer
5' GCAGCGTGCTGTTCATCCT 3'
Table 3.1 RT-PCR mixture contents.Component
Volume (µl)/Reaction Kit
With Rnase Inhibitor Kit
Without Rnase Inhibitor
10X RT Buffer
2.0
2.0
25X dNTP Mix (100mM)
0.8
0.8
10X RT Random Primer
2.0
2.0
MultiScribeTM Reverse Transcriptase
1.0
1.0
Rnase Inhibitor
1.0
-
Nuclease-free H2O
3.2
4.2
Total per Reaction
10.0
10.0
Table 3.2 RT-PCR conditions.
Step 1
Step 2
Step 3
Step 4
Temperature
25
37
85
4
Time
10 min
120 min
5 min
-
3.9 Real-time PCRReal-time PCR is a powerful and rapid technique for amplification and quantitation of target nucleic acids. The accumulation of specific products in a reaction is monitored continuously during cycling. This is usually achieved by monitoring changes in fluorescence within the PCR tube. Besides TaqMan®, there are two other types of fluorescence monitoring chemistries available for real-time PCR methods, the molecular beacon method and the SYBR® Green method.
To study the differential expression levels of CHS in wild-type and cultivated bananas, Real-time PCR was performed using Real-Time Quantitative PCR 7500 (Applied Biosystmes, U.S.A) in the presence of SYBR-green. The optimization of the real-time PCR reaction was performed according to the manufacturer's instructions (Applied-Biosystems, SYBR-Green I reagent protocol). The PCR conditions were standard (SYBR-Green I reagent protocol) and all reagents were provided in the SYBR-Green I reagent kit.
3.9.1 Quantitative real-time PCR AssayQuantitative real-time PCR was used to assay the specific expression of CHS gene in different tissues of banana. 96-well Optical Reaction Plate are obtained from Applied Biosystems, U.S.A. SYBR Green PCR Master Mix is obtained from Applied Biosystems, UK. 8-well PCR tube-strips are obtained from Applied Biosystems, U.S.A and the optical adhesive cover from Applied Biosystems, U.S.A.
3.9.2 SYBR Green ІIn this experiment, the DNA intercalating dye, SYBR Green 1 was used as the reporter fluorophore. It works like ethidium bromide by binding double-stranded DNA, which is the product of the PCR. As the reaction cycle progress, the instrument monitors and records the increase in fluorescence over time. In addition to the regular PCR components, the SYBR Green assay only requires a validated primer pair. One advantage of SYBR Green compared to TaqMan is that the initial assay preparation requires only a few days for primer design and validation.
SYBR Green have a slight edge in sensitivity at >10 copies because the reporter dye binds to any double-stranded DNA present in the reaction, and does not require a probe-cleavage event for the fluorescence detection, as does TaqMan. The result is detected at earlier cycles of the PCR product. This is critically important in the case of low-abundance transcripts (>10 copies), where the number of PCR cycles required for fluorescence detection above background might be beyond the range of cycles in the TaqMan, but not the SYBR assay.
The disadvantage of SYBR Green over TaqMan is the double-stranded DNA binding property because non-specific products and mRNAs with high sequence identity may be detected (Angie et al., 2003).
3.9.3 Endogenous NormalizerOne of the experimental controls either loading or internal control is included in a gene-expression assay. It is used to normalize the signal value of each sample so that the differences between samples are the result of a real biological difference and not because of inconsistent loading. Housekeeping genes are the typical choice according to their mostly consistent expression levels in all cell types. Glyceraldehydes 3-phosphate dehydrogenase (GAPDH), β-actin, cyclophilin, and 18S rRNA is commonly used (Angie et al., 2003). In this experiment, β-actin (FW: 5' GGAATTCCTCCAGCTGCCACTTACTCC 3'; Rev: 5' AGAGCTCTTGAGCAGG GTAGCACTCTTGG 3') was used as typical housekeeping gene.
CHAPTER 4RESULTS4.1 RNA ExtractionHigh-quality total RNA was obtained by using the CTAB modified RNA isolation method (Ying, 2002). The range of yields of total RNA (µg/µl) from the different parts of the plant were as follows: 555-2917 for leaf, 494-1866 for stem, 455-1469 for root, 812-1916 for flower, and 658-684 for fruit tissues (Table 4.1). The extraction protocol used was efficient in yielding a high quality and quantity of total RNA from all the banana tissues and stages tested. However, mature banana tissues consisting of leaf, stem, root, flower (male bud) and fruit (pulp) produced higher-quality and higher-yield of total RNA, which was sufficient for cDNA library construction.
To accumulate enough total RNA, it was necessary to extract RNA from 400-700 mg of mature leaf, stem, root, fruit (pulp) and flower (male bud) respectively. The total RNA and any degradation in the RNA preparation were easily visualized on an EtBr agarose gel. The RNA integrity was assessed by the sharpness of ribosomal RNA bands visualized on an EtBr agarose gel.
For all wild-type RNA samples tested, distinct 28S and 18S RNA bands without any smearing and degradation were observed ( 4.1(A)). For all Mas samples RNA extraction yielded high-quality total RNA were indicated by sharp bands of large subunit RNA ( 4.2(A)). For all samples, OD A260/280 ratios ranged from 1.7-2.15, indicating that the RNA was of high purity, with minimal protein contamination, polyphenol and polysaccharide contamination (Table 4.1).
Table 4.1 RNA yield and quality using spectrophotometry.Banana Tissue
Species
Absorbency Ratios
OD A260/280
Yield
mg/µl
Leaf
Stem
Root
Flower
(male bud)
Fruit
(pulp)
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
2.01
2.08
2.12
1.70
2.12
1.84
1.88
2.15
1.92
1.70
0.555
2.917
0.494
1.866
0.455
1.469
0.812
1.916
0.684
0.658
A.
B.
4.1 (A) Agarose gel electrophoresis of total RNA from Musa acuminata malaccensis (Wild-type); Lane 1, leaf; Lane 2, Stem; Lane 3, Root; Lane 4, Flower (male bud); Lane 5, Fruit (pulp); M, Low Range RNA marker (Fermentas). (B) Agarose gel electrophoresis of total RNA from Musa acuminata malaccensis (Wild-type) after DNase treatment; Lane 1, leaf; Lane 2, Stem; Lane 3, Root; Lane 4, Flower (male bud); Lane 5, Fruit (pulp); M, Low Range RNA marker (Fermentas).
4.2 DNase treatmentThe extracted RNA could be used for further analyses as demonstrated by cDNA library construction and RT-PCR. To obtain pure RNA from the initial total nucleic acid extracts, DNA was selectively removed by the use of Deoxyribonuclease1Amplificaton Grade (DNase 1 Amp Grade) which proved to be more efficient than other methods.
The DNase digestion step resulted in wild-type RNA extracts that were free of DNA upon visual inspection after gel electrophoresis ( 4.1(B)). The DNase treatment results of total RNA from Mas samples were clearly demonstrated by sharp bands after gel electrophoresis ( 6.2(B)). After synthesis of cDNA normalized cDNA libraries were successfully constructed from leaf, stem, root, flower (male bud) and fruit (pulp) tissues.
4.2 (A) Agarose gel electrophoresis of total RNA from Musa acuminata Colla (Mas); Lane 1, leaf; Lane 2, Stem; Lane 3, Root; Lane 4, Flower (male bud); Lane 5, Fruit (pulp), M; 100bp DNA Ladder. (B) Agarose gel electrophoresis of total RNA from Musa acuminata Colla (Mas) after DNase treatment; 1, leaf; Lane 2, Stem; Lane 3, Root; Lane 4, Flower (male bud); Lane 5, Fruit (pulp); M, Low Range RNA marker (Fermentas).
4.3 cDNA Quality and YieldUsing the modified conditions, 450-3000µg total RNA was obtained from 400mg fresh samples. The A260/A280 ratios consistently ranged from 1.75-2. The quality of the RNA was also demonstrated using RT-PCR. Table 4.2 shows the high quality cDNA concentration and purity. Using the High Capacity cDNA Reverse Transcription Kits (Applied Biosystems), we successfully cloned full-length cDNA with high-sequence similarity to Musa acuminata partial chs gene for putatative chalcone synthase as verified by a database search. A similar amplicon (data not shown) was obtained from total RNA as template.
Therefore, this fragment was used as template to carry out real-time quantitative PCR for further analysis of gene expression. For each new plant species being studied, RNA isolation protocols have to be adjusted and optimized (Ying et al., 2002). Even the simplest modifications have proved to be efficient as in the case described here.
Table 4.2 cDNA yield and quality using spectrophotometry.Banana Tissue
Species
Absorbency Ratios
OD A260/280
Yield
ng/µl
Leaf
Stem
Root
Flower
(male bud)
Fruit
(pulp)
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
Wild type, Musa acuminata malaccensis
Mas, Musa acuminata Colla
1.88
1.74
1.92
1.89
1.81
1.94
1.76
1.76
1.81
1.79
2107.6
2292.0
2021.7
2085.2
2399.0
1930.1
2557.0
3270.6
3041.6
1940.2
4.4 Expression of CHS gene in wild type and cultivated banana (Mas)To investigate the parthenocarpic formation in unseeded banana and differential gene expression levels in both wild type and cultivar (Mas) which is likely to be related to the mutation in chalcone synthase gene and parthenocarpic in banana, different cDNA of fruit (pulp), flower, leaf, root and stem samples were studied using real-time quantitative PCR 7500 (Applied Biosystems) in the presence of SYBR-green.
Quantitative real-time PCR analysis revealed an abundance of CHS transcripts in all samples of both wild type and Mas. The highest levels of CHS transcripts were detected in stem (control) which is higher than all of the samples and even other controls. Some members of the CHS multigene family are expressed in leaves, fruit (pulp), flower, stem and root samples of wild type, malaccensis. CHS transcripts have also expressed in leaves, fruit (pulp), flower, stem and root samples of Mas with a major PCR product of the expected length approximately 150 bp was obtained (data not shown).
Interestingly, CHS gene was expressed in wild type Musa acuminata malaccensis of fruit (pulp), flower, leaf, root and stem (control), however, its expression was increased and upregulated as shown in ( 4.3). Surprisingly, CHS gene expression of Mas, Musa acuminata Colla of fruit (pulp), flower, leaf, root and stem was reduced and downnregulated according to QPCR analyses.
To confirm whether the cDNA isolated from wild type banana of Musa acuminata malaccensis encoding CHS was expressed higher than CHS in cultivated banana Mas, Musa acuminata Colla, comparative ∆Ct analyzed was carried out with wild type samples as references (calibrator) by providing accurate data ( 4.4). Interestingly, this result may help to explain why parthenocarpy is formed in unseeded banana and mutation caused in chalcone synthase gene.
4.3 Quantitative real-time PCR analysis by a SYBR Green 1 assay. Steady-state RNA levels of Mas, Musa acuminata Colla CHS relative to the housekeeping gene (β-actin) was measured in leaf, fruit (pulp), flower, stem and root and control lines. Values represent the average of three replicates from each sample. Expression levels in control were set to 1. Control (wild type), each sample (Mas). C: Control, FrW: Fruit Wild type, FrM; Fruit Mas, SW: Stem Wild type, SM: Stem Mas, FlW: Flower W
Article name: Chalcone synthase essay, research paper, dissertation