Telomerase RNP Telomere Interaction

Human chromosomes end in a set of tandem repeats named as Telomeres; these regions are neither coding nor junks and are essential in preventing chromosome fusion, random DNA binding and damage.(1).But the lagging strand DNA polymerase fails to replicate these telomeric DNAs(2)Thus in each division it should result in a shorter chromosome. Gradual and continual loss of these telomeric repeats can affect the transcription pattern of the genes or can arrest growth.

To counteract this, human cells use a ribonucleoprotein complex named Telomerase, which is specifically appointed for the telomeric DNA replication.(1) Telomerase: Telomerase is a ribonucleic protein complex that typically adds (TTAGGG)n oligonucleotide sequences at the telomere region of chromosome and prevents gradual loss of chromosomal DNA. The protein composition of human telomerase was identified in 2007 by Scott Cohen and his team in Australia.

They confirmed the Telomerase to be a heterodimer ,the dimmers being of human telomerase reverse transcriptase (TERT), telomerase RNA (TR/TERC)& dyscerin(DKC1) As its evident the TERT uses TERC as template of the existing DNA and adds up 5'-TTAGGG to the lagging strand. The template region of TERC is 3'-CAAUCCCAAUC-5'.In action, the telomerase binds first few nucleotides of template to the last telomere sequence on the chromosome, adds the next telomeric repeat of 5'-GGTTAG-3' sequence..leaves it and realigns the new 3'-end of telomere to the template, and repeats the process.If a cell keeps on growing and dividing without telomerase, it is most likely to lose DNA from telomere and eventually reach its Hayflick limit but when dividing with telomerase present it can make up for the loss of the genetic data.

As a proof it was found that, embryonic stem cells and highly dividing adult cells do express higher level of telomerase activity whereas normal somatic cells have lesser expression unless any cancerous alteration has taken place. This makes the interaction of telomerase an important study target for cancer, aging & other diseases and also as a drug target for cancer or lifestyle drugs.A lot of classical and advanced biophysical techniques have regularly been applied to understand the cellular mechanism of telomerase interaction some of which are are being highlighted here.1.Single molecule assay for telomerase function analysis Though the structural and biochemical studies well emphasizes the telomerase ribonucleoprotein telomere interaction, but the structure of telomerase RNP is not well established. This assay uses single molecule FRET to demonstrate the structure and correlation with its catalytic activity.

Oligonucleotide hybridization is used to probe the primer extension. Single nucleotide sensitivity ensured the specificity of the enzyme binding events. Telomerase was reconstructed with FRET labeled RNAs and primer extension was performed. The FRET signals obtained during bindings were used and analysed to determine the organization of TERC in the active holoenzyme. Interpretation of Result: This single molecule telomerase activity assay with single molecule resolution appreciates the individual primer bound telomerase RNP structures.

The enzyme activity and processivity can also be determined from the data generated. The FRET measurement reveals the enzyme structural heterogeneity. Further probing of catalytic reaction product of individual RNPs show individual binding pattern and affinity of the elongation products2.ELIPA: Luciferin mediated bioluminescent method for telomerase activity Elongation of telomeric repeats also releases six PPi for each TTAGGG repeat. These PPi were converted to ATP by sulfurylase.(r12) Then the ATP production was measured by luciferase bioluminescent method.(r13,r14) The result is in fmolTTAGGG/ug.Results: .Clinical chemistry 2002;48: 1016-10203.Dual labeled telomere sensing probe based quantitative assay by This technique utilizes telomere specific single stranded probes, labelled dually with fluorescent cyanin3/Cy3 and non fluorescent lowablack/BHQ dyes.

This probes essentially carried the sequences 5′-CCTAACCCTAACCCTA-3′ so were able to hybridize on the telomerase product. The fuloroscent intensity was recorded at 544 and 590nm against controls carrying a)non sense standard and b)standard without any oliginucleotide.Result: Journal of Biochemical and biophysical methods, vol. 70,Pages 503-5064. Rapid biosensor chip assay using SPR This technique measures telomeric repeat elongation by Surface Plasmon Resonance.5′‐Biotinylated oligomers were immobilized on dextran surface, pretreated with streptavidin.

These oligomers essentially carried a sequence B5′‐AATCCGTCGAGCAGAGTTAGGGTTAGGGTTAGGGTTAGGGTTAG‐3′. This compliments the telomerase repeats, so when telomerase extracts were injected, they bound with these sequences and elongation took place. The signals gave the rate of telomerase repeat elongateion activity. Result: Nucleic Acids Research. (2003) 31 (2): e4 Upper line:sample(5'Biotin), Lower line :blank(3'Biotin)5.

Magnetic Bead and Nanoparticle Based Electrochemiluminescence(ECL) assay for Telomerase Activity This is an assay without any PCR amplification steps.In this assay ECL,with numerous ECL tags probes are hybridized with telomerase product and then they are captured by streptavidin coated magnetic bead thus both immobilizing and separating. The light signal emitted, which should be directly proportional to telomerase activity, is measured at the surface of platinum electrode to get the result. Results: Analytical chemistry, 2009, 81 (1), pp 255-261

 

Probe ECL signal set up design The ECL signal

Conclusion:

The few biophysical techniques detailed above indicate the how much that has been effective for greater understanding of Telomerase Telomere interaction. From a better understanding of telomeric RNP structure in the holoenzyme ,to its binding affinity of telomerase to its target or the rate of telomeric repeat addition in cancerous cells, a lot of this interaction is well characterized now with the help of techniques like FRET, SPR, affinity chromatography or chemiluminescence. The telomerase having obvious essential role in normal cellular replication and an altered role in cancerous cell, structure, molecular dynamics and effects on cellular level altogether has been of great interests to cell biologist.

With more developments is these techniques and altenative ideas to improve existing techniques more of this unusual RNP-DNA interaction will be known..and the more problems related to cancer, ageing and diseases will probably be addressed.

Article name: Telomerase RNP Telomere Interaction essay, research paper, dissertation